Review



snail cdna  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    OriGene snail cdna
    Snail Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/snail+cdna/10__1158_slash_0008___5472__can___19___0442-74-16-21?v=OriGene
    Average 90 stars, based on 1 article reviews
    snail cdna - by Bioz Stars, 2026-08
    90/100 stars

    Images



    Similar Products

    90
    Sino Biological snail sino biol hg16844 ut overexpression vectors
    Snail Sino Biol Hg16844 Ut Overexpression Vectors, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/snail+cdna/pm33313663-50-24-25?v=Sino+Biological
    Average 90 stars, based on 1 article reviews
    snail sino biol hg16844 ut overexpression vectors - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    93
    Addgene inc snail cdna
    Snail is required for inhibition of EMT by urolithin A in lung cancer cells. ( A ) Western blot demonstrates decreased Snail expression following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in H1299 and A549 cell lines compared with Slug, Twist and Zeb1. ( B ) The cells transfected with a control or Snail-specific siRNA. At 48 h post-transfection, cells were stimulated with urolithin A for additional 10 h. Western blotting shows that the expression of E-cadherin was increased in cells transfected with a Snail siRNA. ( C ) A549 and H460 cells were transfected with a Snail <t>cDNA.</t> After 48 h, cells were untreated or treated with the indicated amounts of urolithin A for 10 h. Western blotting shows that the urolithin A-induced levels of E-Cadherin decreased further in the cells transfected with a Snail cDNA. ( D ) The cell migration of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment (urolithin A 0, 10 μM) was assessed by the Wound healing assay. The quantification was present in right panels. (* P <0.01, ** P <0.01, *** P <0.001 for the difference from the control cells). ( E ) The cell invasion and motility of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment were assessed by the Cell Invasion Assay. (** P <0.01, *** P <0.001 for the difference from the control cells).
    Snail Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/snail+cdna/pmc08139733-53-6-19?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    snail cdna - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    90
    OriGene snail cdna
    Snail is required for inhibition of EMT by urolithin A in lung cancer cells. ( A ) Western blot demonstrates decreased Snail expression following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in H1299 and A549 cell lines compared with Slug, Twist and Zeb1. ( B ) The cells transfected with a control or Snail-specific siRNA. At 48 h post-transfection, cells were stimulated with urolithin A for additional 10 h. Western blotting shows that the expression of E-cadherin was increased in cells transfected with a Snail siRNA. ( C ) A549 and H460 cells were transfected with a Snail <t>cDNA.</t> After 48 h, cells were untreated or treated with the indicated amounts of urolithin A for 10 h. Western blotting shows that the urolithin A-induced levels of E-Cadherin decreased further in the cells transfected with a Snail cDNA. ( D ) The cell migration of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment (urolithin A 0, 10 μM) was assessed by the Wound healing assay. The quantification was present in right panels. (* P <0.01, ** P <0.01, *** P <0.001 for the difference from the control cells). ( E ) The cell invasion and motility of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment were assessed by the Cell Invasion Assay. (** P <0.01, *** P <0.001 for the difference from the control cells).
    Snail Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/snail+cdna/10__1158_slash_0008___5472__can___19___0442-74-16-21?v=OriGene
    Average 90 stars, based on 1 article reviews
    snail cdna - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    86
    TaKaRa snail cdna
    Snail is required for inhibition of EMT by urolithin A in lung cancer cells. ( A ) Western blot demonstrates decreased Snail expression following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in H1299 and A549 cell lines compared with Slug, Twist and Zeb1. ( B ) The cells transfected with a control or Snail-specific siRNA. At 48 h post-transfection, cells were stimulated with urolithin A for additional 10 h. Western blotting shows that the expression of E-cadherin was increased in cells transfected with a Snail siRNA. ( C ) A549 and H460 cells were transfected with a Snail <t>cDNA.</t> After 48 h, cells were untreated or treated with the indicated amounts of urolithin A for 10 h. Western blotting shows that the urolithin A-induced levels of E-Cadherin decreased further in the cells transfected with a Snail cDNA. ( D ) The cell migration of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment (urolithin A 0, 10 μM) was assessed by the Wound healing assay. The quantification was present in right panels. (* P <0.01, ** P <0.01, *** P <0.001 for the difference from the control cells). ( E ) The cell invasion and motility of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment were assessed by the Cell Invasion Assay. (** P <0.01, *** P <0.001 for the difference from the control cells).
    Snail Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/snail+cdna/pmc06325528-208-18-16?v=TaKaRa
    Average 86 stars, based on 1 article reviews
    snail cdna - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    90
    Cell Biolabs Inc cdnas of human tel2 and snail
    Snail is required for inhibition of EMT by urolithin A in lung cancer cells. ( A ) Western blot demonstrates decreased Snail expression following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in H1299 and A549 cell lines compared with Slug, Twist and Zeb1. ( B ) The cells transfected with a control or Snail-specific siRNA. At 48 h post-transfection, cells were stimulated with urolithin A for additional 10 h. Western blotting shows that the expression of E-cadherin was increased in cells transfected with a Snail siRNA. ( C ) A549 and H460 cells were transfected with a Snail <t>cDNA.</t> After 48 h, cells were untreated or treated with the indicated amounts of urolithin A for 10 h. Western blotting shows that the urolithin A-induced levels of E-Cadherin decreased further in the cells transfected with a Snail cDNA. ( D ) The cell migration of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment (urolithin A 0, 10 μM) was assessed by the Wound healing assay. The quantification was present in right panels. (* P <0.01, ** P <0.01, *** P <0.001 for the difference from the control cells). ( E ) The cell invasion and motility of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment were assessed by the Cell Invasion Assay. (** P <0.01, *** P <0.001 for the difference from the control cells).
    Cdnas Of Human Tel2 And Snail, supplied by Cell Biolabs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/snail+cdna/pmc06156863-31-7-13?v=Cell+Biolabs+Inc
    Average 90 stars, based on 1 article reviews
    cdnas of human tel2 and snail - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    OriGene nm 005985 human cdna
    Snail is required for inhibition of EMT by urolithin A in lung cancer cells. ( A ) Western blot demonstrates decreased Snail expression following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in H1299 and A549 cell lines compared with Slug, Twist and Zeb1. ( B ) The cells transfected with a control or Snail-specific siRNA. At 48 h post-transfection, cells were stimulated with urolithin A for additional 10 h. Western blotting shows that the expression of E-cadherin was increased in cells transfected with a Snail siRNA. ( C ) A549 and H460 cells were transfected with a Snail <t>cDNA.</t> After 48 h, cells were untreated or treated with the indicated amounts of urolithin A for 10 h. Western blotting shows that the urolithin A-induced levels of E-Cadherin decreased further in the cells transfected with a Snail cDNA. ( D ) The cell migration of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment (urolithin A 0, 10 μM) was assessed by the Wound healing assay. The quantification was present in right panels. (* P <0.01, ** P <0.01, *** P <0.001 for the difference from the control cells). ( E ) The cell invasion and motility of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment were assessed by the Cell Invasion Assay. (** P <0.01, *** P <0.001 for the difference from the control cells).
    Nm 005985 Human Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/snail+cdna/pmc05705820-406-3-9?v=OriGene
    Average 90 stars, based on 1 article reviews
    nm 005985 human cdna - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    OriGene d e rev ttcctctgtgcgccgctctctcccaggacaggcac 534 snai1 nm 005985 human cdna
    Snail is required for inhibition of EMT by urolithin A in lung cancer cells. ( A ) Western blot demonstrates decreased Snail expression following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in H1299 and A549 cell lines compared with Slug, Twist and Zeb1. ( B ) The cells transfected with a control or Snail-specific siRNA. At 48 h post-transfection, cells were stimulated with urolithin A for additional 10 h. Western blotting shows that the expression of E-cadherin was increased in cells transfected with a Snail siRNA. ( C ) A549 and H460 cells were transfected with a Snail <t>cDNA.</t> After 48 h, cells were untreated or treated with the indicated amounts of urolithin A for 10 h. Western blotting shows that the urolithin A-induced levels of E-Cadherin decreased further in the cells transfected with a Snail cDNA. ( D ) The cell migration of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment (urolithin A 0, 10 μM) was assessed by the Wound healing assay. The quantification was present in right panels. (* P <0.01, ** P <0.01, *** P <0.001 for the difference from the control cells). ( E ) The cell invasion and motility of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment were assessed by the Cell Invasion Assay. (** P <0.01, *** P <0.001 for the difference from the control cells).
    D E Rev Ttcctctgtgcgccgctctctcccaggacaggcac 534 Snai1 Nm 005985 Human Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/snail+cdna/10__1128_slash_mcb__00328___17-165-127-137?v=OriGene
    Average 90 stars, based on 1 article reviews
    d e rev ttcctctgtgcgccgctctctcccaggacaggcac 534 snai1 nm 005985 human cdna - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma pex-2 plasmids containing the full-length cdna of human cx32 and snail
    Snail is required for inhibition of EMT by urolithin A in lung cancer cells. ( A ) Western blot demonstrates decreased Snail expression following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in H1299 and A549 cell lines compared with Slug, Twist and Zeb1. ( B ) The cells transfected with a control or Snail-specific siRNA. At 48 h post-transfection, cells were stimulated with urolithin A for additional 10 h. Western blotting shows that the expression of E-cadherin was increased in cells transfected with a Snail siRNA. ( C ) A549 and H460 cells were transfected with a Snail <t>cDNA.</t> After 48 h, cells were untreated or treated with the indicated amounts of urolithin A for 10 h. Western blotting shows that the urolithin A-induced levels of E-Cadherin decreased further in the cells transfected with a Snail cDNA. ( D ) The cell migration of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment (urolithin A 0, 10 μM) was assessed by the Wound healing assay. The quantification was present in right panels. (* P <0.01, ** P <0.01, *** P <0.001 for the difference from the control cells). ( E ) The cell invasion and motility of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment were assessed by the Cell Invasion Assay. (** P <0.01, *** P <0.001 for the difference from the control cells).
    Pex 2 Plasmids Containing The Full Length Cdna Of Human Cx32 And Snail, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/snail+cdna/pmc05435329-73-14-21?v=Shanghai+GenePharma
    Average 90 stars, based on 1 article reviews
    pex-2 plasmids containing the full-length cdna of human cx32 and snail - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    Image Search Results


    Snail is required for inhibition of EMT by urolithin A in lung cancer cells. ( A ) Western blot demonstrates decreased Snail expression following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in H1299 and A549 cell lines compared with Slug, Twist and Zeb1. ( B ) The cells transfected with a control or Snail-specific siRNA. At 48 h post-transfection, cells were stimulated with urolithin A for additional 10 h. Western blotting shows that the expression of E-cadherin was increased in cells transfected with a Snail siRNA. ( C ) A549 and H460 cells were transfected with a Snail cDNA. After 48 h, cells were untreated or treated with the indicated amounts of urolithin A for 10 h. Western blotting shows that the urolithin A-induced levels of E-Cadherin decreased further in the cells transfected with a Snail cDNA. ( D ) The cell migration of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment (urolithin A 0, 10 μM) was assessed by the Wound healing assay. The quantification was present in right panels. (* P <0.01, ** P <0.01, *** P <0.001 for the difference from the control cells). ( E ) The cell invasion and motility of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment were assessed by the Cell Invasion Assay. (** P <0.01, *** P <0.001 for the difference from the control cells).

    Journal: OncoTargets and therapy

    Article Title: Urolithin A Inhibits Epithelial–Mesenchymal Transition in Lung Cancer Cells via P53-Mdm2-Snail Pathway

    doi: 10.2147/OTT.S305595

    Figure Lengend Snippet: Snail is required for inhibition of EMT by urolithin A in lung cancer cells. ( A ) Western blot demonstrates decreased Snail expression following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in H1299 and A549 cell lines compared with Slug, Twist and Zeb1. ( B ) The cells transfected with a control or Snail-specific siRNA. At 48 h post-transfection, cells were stimulated with urolithin A for additional 10 h. Western blotting shows that the expression of E-cadherin was increased in cells transfected with a Snail siRNA. ( C ) A549 and H460 cells were transfected with a Snail cDNA. After 48 h, cells were untreated or treated with the indicated amounts of urolithin A for 10 h. Western blotting shows that the urolithin A-induced levels of E-Cadherin decreased further in the cells transfected with a Snail cDNA. ( D ) The cell migration of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment (urolithin A 0, 10 μM) was assessed by the Wound healing assay. The quantification was present in right panels. (* P <0.01, ** P <0.01, *** P <0.001 for the difference from the control cells). ( E ) The cell invasion and motility of A549 and H460 after transfection of Snail cDNAs and urolithin A treatment were assessed by the Cell Invasion Assay. (** P <0.01, *** P <0.001 for the difference from the control cells).

    Article Snippet: The plasmids of Snail promoter (no.31694), Snail cDNA (no.16218), mdm2 cDNA (no.16233),p53 cDNA (no.69003),p53 shRNA (no.28222) were purchased from Addgene.

    Techniques: Inhibition, Western Blot, Expressing, Transfection, Control, Migration, Wound Healing Assay, Invasion Assay

    Urolithin A induces Snail degradation via mdm2-mediated ubiquitination. ( A ) A549 and H460 cells were treated with urolithin A (0, 10 and 20 μM) for 5 h. The expression of Snail gene was detected by RT-PCR. (ns means no statistical difference). ( B ) A549 and H460 cells were co-transfected with a plasmid of the Snail promoter luciferase reporter gene with a plasmid of control Renilla luciferase reporter gene. At 36 h after transfection, cells were treated with urolithin A (0, 5, 10 and 20 μM) for 5 h, and luciferase activity was detected using the dual luciferase reporter system. (ns means no statistical difference). ( C ) Cells were treated with CHX (Cycloheximide, 50 μg/mL) for the indicated time in the presence or absence of urolithin A. Western blot was used to determine Snail protein levels. ( D ) Western blotting analysis of Snail, p62 and LC3A/B after cells were pre-treated with 20 μM HCQ for 1 h and then treated with urolithin A (0, 10 and 20 μM) for 5 h in A549 and H460 cells. ( E ) Western blotting analysis of Snail, after cells were pre-treated with 20 μM PII for 1 h and then treated with urolithin A (0, 10 and 20 μM) for 5 h in A549 and H460 cells. ( F ) Cells were treated with urolithin A after which cell lysates were immunoprecipitated with anti-Snail antibody and then Western blotted with anti-Ubiquitin. ( G ) Western blot examined mdm2 expression flowing 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in A549 and H460 cells. ( H and I) After transfection with mdm2 cDNA ( H ) or mdm2 siRNA ( I ) for 48 h, A549 and H460 cells were treated with urolithin A (0, 10 and 20 μM) for 5 h. Western blot was carried out for analysis of Snail levels. ( J ) Cells were treated with urolithin A for 5 h after which cell lysates were immunoprecipitated with anti-mdm2 antibody and then Western blotted with anti-Snail.

    Journal: OncoTargets and therapy

    Article Title: Urolithin A Inhibits Epithelial–Mesenchymal Transition in Lung Cancer Cells via P53-Mdm2-Snail Pathway

    doi: 10.2147/OTT.S305595

    Figure Lengend Snippet: Urolithin A induces Snail degradation via mdm2-mediated ubiquitination. ( A ) A549 and H460 cells were treated with urolithin A (0, 10 and 20 μM) for 5 h. The expression of Snail gene was detected by RT-PCR. (ns means no statistical difference). ( B ) A549 and H460 cells were co-transfected with a plasmid of the Snail promoter luciferase reporter gene with a plasmid of control Renilla luciferase reporter gene. At 36 h after transfection, cells were treated with urolithin A (0, 5, 10 and 20 μM) for 5 h, and luciferase activity was detected using the dual luciferase reporter system. (ns means no statistical difference). ( C ) Cells were treated with CHX (Cycloheximide, 50 μg/mL) for the indicated time in the presence or absence of urolithin A. Western blot was used to determine Snail protein levels. ( D ) Western blotting analysis of Snail, p62 and LC3A/B after cells were pre-treated with 20 μM HCQ for 1 h and then treated with urolithin A (0, 10 and 20 μM) for 5 h in A549 and H460 cells. ( E ) Western blotting analysis of Snail, after cells were pre-treated with 20 μM PII for 1 h and then treated with urolithin A (0, 10 and 20 μM) for 5 h in A549 and H460 cells. ( F ) Cells were treated with urolithin A after which cell lysates were immunoprecipitated with anti-Snail antibody and then Western blotted with anti-Ubiquitin. ( G ) Western blot examined mdm2 expression flowing 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in A549 and H460 cells. ( H and I) After transfection with mdm2 cDNA ( H ) or mdm2 siRNA ( I ) for 48 h, A549 and H460 cells were treated with urolithin A (0, 10 and 20 μM) for 5 h. Western blot was carried out for analysis of Snail levels. ( J ) Cells were treated with urolithin A for 5 h after which cell lysates were immunoprecipitated with anti-mdm2 antibody and then Western blotted with anti-Snail.

    Article Snippet: The plasmids of Snail promoter (no.31694), Snail cDNA (no.16218), mdm2 cDNA (no.16233),p53 cDNA (no.69003),p53 shRNA (no.28222) were purchased from Addgene.

    Techniques: Ubiquitin Proteomics, Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Plasmid Preparation, Luciferase, Control, Activity Assay, Western Blot, Immunoprecipitation

    Urolithin A upregulates mdm2 by inhibiting the interaction of p53 and mdm2. ( A ) H1299 cells were treated with different concentrations of urolithin A (0, 5, 10, 15, 20 and 25 μM) for 5 h. Western blot examined the expression of mdm2. ( B ) Western blot demonstrates expression of p53 following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in indicated lung cancer cell lines. ( C ) Cells were treated with urolithin A for 5 h after which cell lysates were immunoprecipitated with anti-p53 antibody and then Western blotted with anti-Ubiquitin and anti-mdm2 antibodies. ( D ) Transfection of A549 and H460 cells with p53 shRNA for 48h, and then treated with different concentrations of urolithin A for 5 h, the expression levels of mdm2 and Snail were analyzed by immunoblotting. ( E and F) Indicated cells were transfected with p53 cDNA. After 48 h, cells were treated with urolithin A (0, 10 and 20 μM) for 5 h. The levels of mdm2 and Snail were detected by Western blotting.

    Journal: OncoTargets and therapy

    Article Title: Urolithin A Inhibits Epithelial–Mesenchymal Transition in Lung Cancer Cells via P53-Mdm2-Snail Pathway

    doi: 10.2147/OTT.S305595

    Figure Lengend Snippet: Urolithin A upregulates mdm2 by inhibiting the interaction of p53 and mdm2. ( A ) H1299 cells were treated with different concentrations of urolithin A (0, 5, 10, 15, 20 and 25 μM) for 5 h. Western blot examined the expression of mdm2. ( B ) Western blot demonstrates expression of p53 following 5 h of urolithin A (0, 5, 10, 15, 20 and 25 μM) stimulation in indicated lung cancer cell lines. ( C ) Cells were treated with urolithin A for 5 h after which cell lysates were immunoprecipitated with anti-p53 antibody and then Western blotted with anti-Ubiquitin and anti-mdm2 antibodies. ( D ) Transfection of A549 and H460 cells with p53 shRNA for 48h, and then treated with different concentrations of urolithin A for 5 h, the expression levels of mdm2 and Snail were analyzed by immunoblotting. ( E and F) Indicated cells were transfected with p53 cDNA. After 48 h, cells were treated with urolithin A (0, 10 and 20 μM) for 5 h. The levels of mdm2 and Snail were detected by Western blotting.

    Article Snippet: The plasmids of Snail promoter (no.31694), Snail cDNA (no.16218), mdm2 cDNA (no.16233),p53 cDNA (no.69003),p53 shRNA (no.28222) were purchased from Addgene.

    Techniques: Western Blot, Expressing, Immunoprecipitation, Ubiquitin Proteomics, Transfection, shRNA